Stem-loop sequence sbi-MIR390

AccessionMI0010887 (change log)
DescriptionSorghum bicolor miR390 stem-loop
Gene family MIPF0000101; MIR390
Literature search

3 open access papers mention sbi-MIR390
(16 sentences)

Stem-loop
   -  a         g         cua   aaacac      u          augag                g c      --gc     gca 
5'  ug agcucagga ggauagcgc   gga      auagau ggagcuagcc     gagaaagagagagaga g agcaga    gagau   u
    || ||||||||| |||||||||   |||      |||||| ||||||||||     |||||||||||||||| | ||||||    |||||    
3'  ac ucgaguccu ucuaucgcg   ucu      uaucug ucuugguugg     cucuuucucuuucucu c ucgucu    cucua   g
   c  c         a         aag   ---aac      -          ---aa                a -      aagu     agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 2876710-2876888 [+]
intergenic
Database links

Mature sequence sbi-miR390

Accession MIMAT0011347
Sequence

3 - 

aagcucaggagggauagcgcc

 - 23

Get sequence
Evidence not experimental

References

1
" Zhang L, Ware D Unpublished (2009).