Stem-loop sequence sme-mir-2156b

AccessionMI0010933 (change log)
DescriptionSchmidtea mediterranea miR-2156b stem-loop
Stem-loop
   -     aacu    -       uu a       au    au 
5'  uucau    gaaa aagguuu  g gccguaa  caaa  a
    |||||    |||| |||||||  | |||||||  ||||   
3'  aagua    cuuu uuccaaa  c cggcauu  guuu  a
   u     aagu    a       uc c       cc    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig877: 48519-48600 [+]
intergenic
Database links

Mature sequence sme-miR-2156b-5p

Accession MIMAT0011393
Previous IDssme-miR-2156b*
Sequence

14 - 

aagguuuuugagccguaaauca

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sme-miR-2156b-3p

Accession MIMAT0011394
Previous IDssme-miR-2156b
Sequence

48 - 

ccuuacggccccuaaaccuuauu

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).