Stem-loop sequence sme-mir-753e

AccessionMI0010934 (change log)
DescriptionSchmidtea mediterranea miR-753e stem-loop
Gene family MIPF0000752; mir-753
Stem-loop
   ----u   -        u           a 
5'      aag gcuugaau gugaucucaua a
        ||| |||||||| |||||||||||  
3'      uuc cgaacuua uacuagaguau c
   auaac   u        u           c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named mir-753g in [1].

Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig7504: 7763-7819 [+]
intergenic
Database links

Mature sequence sme-miR-753e-5p

Accession MIMAT0012168
Previous IDssme-miR-753e*
Sequence

3 - 

aggcuugaauugugaucuca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sme-miR-753e-3p

Accession MIMAT0012169
Previous IDssme-miR-753e
Sequence

31 - 

ugagaucauuauucaagcucuuc

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).