Stem-loop sequence sme-mir-76

AccessionMI0010935 (change log)
DescriptionSchmidtea mediterranea miR-76 stem-loop
Literature search

1 open access papers mention sme-mir-76
(1 sentences)

Stem-loop
   ---gaua        --      u             g   u    
5'        aacauuuu  ucauuc uaaacaaugaaua uuu ucc 
          ||||||||  |||||| ||||||||||||| ||| || a
3'        uuguaaag  aguaag auuuguugcuuau aaa agu 
   uuuacga        ag      u             g   c    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig18565: 5370-5455 [+]
intergenic
Contig20679: 1223-1308 [+]
intergenic
Contig26227: 10704-10789 [-]
intergenic
Database links

Mature sequence sme-miR-76-5p

Accession MIMAT0011396
Previous IDssme-miR-76*
Sequence

13 - 

ucauucuuaaacaaugaaua

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sme-miR-76-3p

Accession MIMAT0011397
Previous IDssme-miR-76
Sequence

52 - 

uucguuguuuaugaaugagaga

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).