Stem-loop sequence sme-mir-2204

AccessionMI0010937 (change log)
DescriptionSchmidtea mediterranea miR-2204 stem-loop
Stem-loop
   ------uac    a    ga    -aa    acc   cu  ca 
5'          ugaa uuag  cgga   uuac   aau  ac  a
            |||| ||||  ||||   ||||   |||  ||  c
3'          auuu aauc  gccu   aaug   uua  ug  a
   cuaacccau    g    ag    aca    --a   au  ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig5212: 12347-12426 [-]
intergenic
Database links

Mature sequence sme-miR-2204-5p

Accession MIMAT0011398
Sequence

4 - 

ugaaauuaggacggaaauuacac

 - 26

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sme-miR-2204-3p

Accession MIMAT0011399
Sequence

52 - 

aaacauccggacuaaguuuau

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).