Stem-loop sequence sme-mir-2e

AccessionMI0010938 (change log)
DescriptionSchmidtea mediterranea miR-2e stem-loop
Stem-loop
   ---------u       -    g        --uu     c      u  cca 
5'           auagguc agau aaaccuag    gguug gauaug ug   u
             ||||||| |||| ||||||||    ||||| |||||| ||    
3'           uauucag ucua uuuggauc    ucgac cuauac au   u
   cuacucuuuu       c    a        ucgu     a      c  aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig272: 56381-56476 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-2e
sme-mir-2167Contig272: 56602-56705 [-]
sme-mir-2fContig272: 56513-56575 [-]
sme-mir-2eContig272: 56381-56476 [-]
Database links

Mature sequence sme-miR-2e-5p

Accession MIMAT0011400
Sequence

14 - 

aaaccuaguugguugcgauaug

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sme-miR-2e-3p

Accession MIMAT0011401
Sequence

52 - 

uaucacagcuugcucuagguuua

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).