Stem-loop sequence sme-mir-2206

AccessionMI0010939 (change log)
DescriptionSchmidtea mediterranea miR-2206 stem-loop
Stem-loop
   ---c        c  a  -ua        cuucucac      a 
5'     agggcagg au gc   agugguua        uggaaa u
       |||||||| || ||   ||||||||        |||||| g
3'     uuccgucc ua cg   ucaccagu        aucuuu g
   cauu        -  g  ugg        --uuacua      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig9421: 12895-12978 [-]
intergenic
Database links

Mature sequence sme-miR-2206-5p

Accession MIMAT0011402
Sequence

2 - 

agggcaggcauagcuaagug

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sme-miR-2206-3p

Accession MIMAT0011403
Sequence

59 - 

accacuggugcgauccugcc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).