Stem-loop sequence sme-mir-2f

AccessionMI0010943 (change log)
DescriptionSchmidtea mediterranea miR-2f stem-loop
Stem-loop
   ggcaa    a   -   a    u     agcu 
5'      ucug agc ugg ugug uauga    u
        |||| ||| ||| |||| |||||     
3'      agac ucg acc acac auacu    u
   --uug    a   u   g    u     auuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig272: 56513-56575 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-2f
sme-mir-2167Contig272: 56602-56705 [-]
sme-mir-2fContig272: 56513-56575 [-]
sme-mir-2eContig272: 56381-56476 [-]
Database links

Mature sequence sme-miR-2f-5p

Accession MIMAT0011410
Previous IDssme-miR-2f
Sequence

5 - 

aucugaagcuggauguguuau

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sme-miR-2f-3p

Accession MIMAT0011411
Previous IDssme-miR-2f*
Sequence

41 - 

uaucacagccaugcuacagaguu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).