Stem-loop sequence sme-mir-2203

AccessionMI0010950 (change log)
DescriptionSchmidtea mediterranea miR-2203 stem-loop
Stem-loop
   a         -gaa  -  uaa      uc     caaa 
5'  aaaauuuac    gg cu   ugauua  auuua    c
    |||||||||    || ||   ||||||  |||||     
3'  uuuugaaug    cu ga   acuaau  uaaau    c
   -         auug  a  ---      --     uaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig43306: 3412-3483 [+]
intergenic
Database links

Mature sequence sme-miR-2203-5p

Accession MIMAT0011419
Previous IDssme-miR-2203*
Sequence

9 - 

acgaaggcuuaaugauuaucau

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sme-miR-2203-3p

Accession MIMAT0011420
Previous IDssme-miR-2203
Sequence

51 - 

aucaagaucguuaguaaguu

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).