Stem-loop sequence sme-mir-2200

AccessionMI0010951 (change log)
DescriptionSchmidtea mediterranea miR-2200 stem-loop
Stem-loop
   aa    g        u   ga  -   auua         auu 
5'   uuuu auacaguu gaa  cg auu    uugauuauu   g
     |||| |||||||| |||  || |||    |||||||||    
3'   aaaa uaugucga cuu  gc uaa    aauuaguag   u
   ua    a        -   aa  c   --aa         agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1580: 76060-76143 [+]
intergenic
Database links

Mature sequence sme-miR-2200-5p

Accession MIMAT0011421
Previous IDssme-miR-2200
Sequence

16 - 

ugaagacgauuauuauugauuauu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sme-miR-2200-3p

Accession MIMAT0011422
Previous IDssme-miR-2200*
Sequence

55 - 

aaaaaauccgaauucagcugu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).