Stem-loop sequence sme-mir-2201

AccessionMI0010952 (change log)
DescriptionSchmidtea mediterranea miR-2201 stem-loop
Stem-loop
   -------------cau      g uca    a  ga   agc       gac 
5'                 gaugcu c   aguu cu  aga   ugaugcu   a
                   |||||| |   |||| ||  |||   |||||||    
3'                 cuacga g   ucga ga  ucu   auuauga   a
   uaauuuuucgauaagc      g ---    a  ag   ---       aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig3745: 19380-19466 [-]
intergenic
Database links

Mature sequence sme-miR-2201-5p

Accession MIMAT0011423
Previous IDssme-miR-2201*
Sequence

15 - 

aguuacugaagaagcugaugcug

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sme-miR-2201-3p

Accession MIMAT0011424
Previous IDssme-miR-2201
Sequence

50 - 

uaucugaagaagcuggagcauc

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).