Stem-loop sequence cbr-mir-238

AccessionMI0010976 (change log)
DescriptionCaenorhabditis briggsae miR-238 stem-loop
Gene family MIPF0000862; mir-238
Stem-loop
   u       a  c   ugaauau      u      u c     u   a     uaua     g 
5'  ucuucuu uc uca       gacugu ugggug c uugga gua aaagc    aaucu u
    ||||||| || |||       |||||| |||||| | ||||| ||| |||||    |||||  
3'  agaagaa ag agu       cuggua accuac g agccu cau uuucg    uuaga u
   -       c  c   -------      c      c u     -   g     ----     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrIII: 14445069-14445183 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-238
cbr-mir-238chrIII: 14445069-14445183 [-]
cbr-mir-80chrIII: 14440871-14440970 [-]
Database links

Mature sequence cbr-miR-238

Accession MIMAT0011465
Sequence

74 - 

uuuguacuccgaugccauccac

 - 95

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).