Stem-loop sequence crm-mir-34

Accession MI0011057
Description Caenorhabditis remanei miR-34 stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-    --g   c   -a a       -u   u     g   -  uau 
 ggac   gug ucg  g ggcagug  ggu agcug uug ca   u
 ||||   ||| |||  | |||||||  ||| ||||| ||| ||    
 ccug   uac agc  c ccgucac  cca ucggc aac gu   g
a    aug   a   cc a       uu   -     -   a  uaa 
Get sequence
Deep sequencing
104 reads, 1 experiments
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig15: 1362286-1362373 [+]
intergenic

Mature sequence crm-miR-34

Accession MIMAT0011538
Sequence

15 - 

aggcagugugguuagcugguug

 - 36

Get sequence
Deep sequencing 104 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).