Stem-loop sequence crm-mir-246-2

AccessionMI0011096 (change log)
DescriptionCaenorhabditis remanei miR-246-2 stem-loop
Gene family MIPF0000260; mir-246
Stem-loop
   a    aaacaaua       a    g     uu            gaa 
5'  gucc        gaacagc ccug ccgau  cauguaauaucu   a
    ||||        ||||||| |||| |||||  ||||||||||||   a
3'  uagg        uuugucg ggau ggcua  guacauuauaga   g
   -    -aaaugag       a    g     -u            aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig20: 644631-644726 [+]
intergenic
Database links

Mature sequence crm-miR-246-5p

Accession MIMAT0011571
Previous IDscrm-miR-246
Sequence

21 - 

accuggccgauuucauguaauau

 - 43

Get sequence
Evidence experimental; 454 [1]

Mature sequence crm-miR-246-3p

Accession MIMAT0011572
Previous IDscrm-miR-246*
Sequence

60 - 

uuacauguaucggguaggag

 - 79

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).