Stem-loop sequence ppc-mir-79

Accession MI0011143
Description Pristionchus pacificus miR-79 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c   g     a  u   c        u    u     c   -  aaau 
 gga aauca cu cuu gcuuuggu aucu gcuuu uga cu    g
 ||| ||||| || ||| |||||||| |||| ||||| ||| ||     
 cuu uuagu gg gaa cgaaacca ugga cgaaa acu gg    u
c   g     -  c   u        u    u     u   u  aacc 
Get sequence
Deep sequencing
117 reads, 1 experiments
Genome context
Coordinates (WS200) Overlapping transcripts
Ppa_Contig177: 113142-113237 [+]
intergenic

Mature sequence ppc-miR-79

Accession MIMAT0011652
Sequence

59 - 

auaaagcuagguuaccaaagcu

 - 80

Get sequence
Deep sequencing 117 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).