Stem-loop sequence ppc-let-7

Accession MI0011149
Description Pristionchus pacificus let-7 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-     c a  ---u    cu   g   -              cggaauaa      c    
 gcgac g gc    ccug  gag uag uagguuguauaguu        uaccaa ugu 
 ||||| | ||    ||||  ||| ||| ||||||||||||||        |||||| || a
 cguug c cg    ggac  uuc auc guccaacaugucaa        gugguu acu 
g     a c  cuac    cg   g   u              -------a      a    
Get sequence
Deep sequencing
63 reads, 1 experiments
Genome context
Coordinates (WS200) Overlapping transcripts
Ppa_Contig31: 197569-197679 [+]
intergenic

Mature sequence ppc-let-7

Accession MIMAT0011657
Sequence

17 - 

ugagguaguagguuguauaguu

 - 38

Get sequence
Deep sequencing 53 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).