Stem-loop sequence ppc-let-7

AccessionMI0011149 (change log)
DescriptionPristionchus pacificus let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

3 open access papers mention ppc-let-7
(9 sentences)

Stem-loop
   -     c a  ---u    cu   g   -              cggaauaa      c    
5'  gcgac g gc    ccug  gag uag uagguuguauaguu        uaccaa ugu 
    ||||| | ||    ||||  ||| ||| ||||||||||||||        |||||| || a
3'  cguug c cg    ggac  uuc auc guccaacaugucaa        gugguu acu 
   g     a c  cuac    cg   g   u              -------a      a    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000119.1: 942519-942629 [-]
intergenic
Database links

Mature sequence ppc-let-7

Accession MIMAT0011657
Sequence

17 - 

ugagguaguagguuguauaguu

 - 38

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).