Stem-loop sequence ppc-mir-2273

AccessionMI0011235 (change log)
DescriptionPristionchus pacificus miR-2273 stem-loop
Stem-loop
   u   ca    uu au           a c  c     c    cga       
5'  ucu  ucga  g  cgucucucgaa g gg acaug cauc   auuaca 
    |||  ||||  |  ||||||||||| | || ||||| ||||   ||||| u
3'  aga  agcu  c  guagagagcuu c cc uguac guag   uaguga 
   a   ug    cu gc           g -  c     a    ---       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000073.1: 220330-220428 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-2273
ppc-mir-2272ABKE03000073.1: 220023-220140 [+]
ppc-mir-8263ABKE03000073.1: 220213-220275 [+]
ppc-mir-2273ABKE03000073.1: 220330-220428 [+]
ppc-mir-8223ABKE03000073.1: 220630-220686 [+]
ppc-mir-2267ABKE03000073.1: 220769-220883 [+]
ppc-mir-8351ABKE03000073.1: 225677-225741 [+]
ppc-mir-8299ABKE03000073.1: 226063-226119 [+]
ppc-mir-8348ABKE03000073.1: 226430-226488 [+]
ppc-mir-8282bABKE03000073.1: 226545-226603 [+]
ppc-mir-8282aABKE03000073.1: 226753-226811 [+]
ppc-mir-8282cABKE03000073.1: 227223-227281 [+]
ppc-mir-8358ABKE03000073.1: 227347-227413 [+]
ppc-mir-8320ABKE03000073.1: 227746-227804 [+]
Database links

Mature sequence ppc-miR-2273

Accession MIMAT0011730
Sequence

20 - 

ucucgaaagcggcacaugccaucc

 - 43

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).