Stem-loop sequence osa-MIR2118a

Accession MI0011251
Description Oryza sativa miR2118a stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop 
g           aaaga    c        ua      c     -a   a           --    ucu   caucua      cc ucc     g 
 ggaagaggaag     gagg uccaagag  guagga uggga  cau ugagaaagcau  gagc   auc      uccauc  c   cauuc c
 |||||||||||     |||| ||||||||  |||||| |||||  ||| |||||||||||  ||||   |||      ||||||  |   |||||  
 ccuucuccuuc     cuuc agguucuu  uauccu acccu  gua gcucuuuugua  cucg   uag      aggugg  g   guaag u
-           -----    a        gc      u     cc   -           uu    cuu   ------      ac -uu     a
Get sequence
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21642923-21643101 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118a
osa-MIR2118h Chr4: 21652652-21652808 [-]
osa-MIR2118i Chr4: 21652388-21652568 [-]
osa-MIR2118f Chr4: 21650514-21650682 [-]
osa-MIR5522 Chr4: 21650324-21650436 [+]
osa-MIR2118g Chr4: 21650301-21650460 [-]
osa-MIR2118c Chr4: 21647968-21648064 [-]
osa-MIR2118d Chr4: 21647689-21647864 [-]
osa-MIR2118e Chr4: 21647428-21647604 [-]
osa-MIR2118b Chr4: 21645285-21645463 [-]
osa-MIR1869 Chr4: 21644852-21644989 [+]
osa-MIR2118a Chr4: 21642923-21643101 [-]

Mature sequence osa-miR2118a

Accession MIMAT0011740
Sequence

131 -  

uucucgaugccucccauuccua

 - 152

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).