![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR2118b |
||||||||||||||||||||||||||
Accession | MI0011252 (change log) | |||||||||||||||||||||||||
Description | Oryza sativa miR2118b stem-loop | |||||||||||||||||||||||||
Gene family | MIPF0000745; MIR2118 | |||||||||||||||||||||||||
Literature search |
![]()
28 open access papers mention osa-MIR2118b | |||||||||||||||||||||||||
Stem-loop |
--- aaa g g a -a a a agcucu - gg 5' augagc gaggaagaggaag gag ua ucuaagagc gugggaauggga cau g ggaaaaaug cag uguucacuucu a |||||| ||||||||||||| ||| || ||||||||| |||||||||||| ||| | ||||||||| ||| ||||||||||| 3' uacucg uuccuucuccuuc cuc gu ggauucuug uauccuuacccu gua c ccuuuuuau guu auagguggagg a acu --- - - c cc g - gacucu u ug |
|||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||
Database links |
|
Mature sequence osa-miR2118b |
|
Accession | MIMAT0011741 |
Sequence |
120 - uucccgaugccucccauuccua - 141 |
Evidence | experimental; 454 [1] |
References |
|
1 |
PMID:19584097
"Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"
Genome Res. 19:1429-1440(2009).
|