Stem-loop sequence osa-MIR2118b

Accession

MI0011252 (change log)

Description

Oryza sativa miR2118b stem-loop

Gene family

MIPF0000745; MIR2118

Literature search

28 open access papers mention osa-MIR2118b
(169 sentences)

Stem-loop

         ---             aaa   g  g         a            -a   a a         agcucu   -           gg 
5' augagc   gaggaagaggaag   gag ua ucuaagagc gugggaauggga  cau g ggaaaaaug      cag uguucacuucu  a
   ||||||   |||||||||||||   ||| || ||||||||| ||||||||||||  ||| | |||||||||      ||| |||||||||||   
3' uacucg   uuccuucuccuuc   cuc gu ggauucuug uauccuuacccu  gua c ccuuuuuau      guu auagguggagg  a
         acu             ---   -  -         c            cc   g -         gacucu   u           ug 

Deep sequencing

7 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr4: 21645285-21645463 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR2118b

• osa-MIR2118j: Chr4: 21654594-21654764 [-]
• osa-MIR2118h: Chr4: 21652652-21652808 [-]
• osa-MIR2118i: Chr4: 21652388-21652568 [-]
• osa-MIR2118f: Chr4: 21650514-21650682 [-]
• osa-MIR5522: Chr4: 21650324-21650436 [+]
• osa-MIR2118g: Chr4: 21650301-21650460 [-]
• osa-MIR2118c: Chr4: 21647968-21648064 [-]
• osa-MIR2118d: Chr4: 21647689-21647864 [-]
• osa-MIR2118e: Chr4: 21647428-21647604 [-]
• osa-MIR2118b: Chr4: 21645285-21645463 [-]
• osa-MIR1869: Chr4: 21644852-21644989 [+]
• osa-MIR2118a: Chr4: 21642923-21643101 [-]

Database links

• miRBase Tracker:MI0011252

Mature sequence osa-miR2118b

• Accession: MIMAT0011741
• Sequence: 120 - uucccgaugccucccauuccua - 141
• Evidence: experimental; 454 [1]

References

1. PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).