Stem-loop sequence osa-MIR2118f

Accession MI0011256
Description Oryza sativa miR2118f stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop 
 ug     ---      a     aacga   g uu   u                -a   g a        ug -  ucuaa       c 
g  agcca   gggaag ggaag     gag g  caa agcagugggaauggga  cau g ggaaagca  a gc     auuuccu c
|  |||||   |||||| |||||     ||| |  ||| ||||||||||||||||  ||| | ||||||||  | ||     |||||||  
c  ucggu   uccuuc ccuuc     cuc u  guu uuguuauccuuacccu  gua u ccuuuugu  u cg     uagagga a
 gu     ucu      c     -----   g gg   c                cc   g -        gu u  --ucc       a
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21650514-21650682 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118f
osa-MIR2118m Chr4: 21658851-21659020 [-]
osa-MIR2118k Chr4: 21656944-21657120 [-]
osa-MIR2118l Chr4: 21656708-21656884 [-]
osa-MIR2118j Chr4: 21654594-21654764 [-]
osa-MIR2118h Chr4: 21652652-21652808 [-]
osa-MIR2118i Chr4: 21652388-21652568 [-]
osa-MIR2118f Chr4: 21650514-21650682 [-]
osa-MIR5522 Chr4: 21650324-21650436 [+]
osa-MIR2118g Chr4: 21650301-21650460 [-]
osa-MIR2118c Chr4: 21647968-21648064 [-]
osa-MIR2118d Chr4: 21647689-21647864 [-]
osa-MIR2118e Chr4: 21647428-21647604 [-]
osa-MIR2118b Chr4: 21645285-21645463 [-]
osa-MIR1869 Chr4: 21644852-21644989 [+]
osa-MIR2118a Chr4: 21642923-21643101 [-]

Mature sequence osa-miR2118f

Accession MIMAT0011745
Sequence

109 -  

uuccugaugccucccauuccua

 - 130

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).