Stem-loop sequence osa-MIR2118i

Accession

MI0011259 (change log)

Description

Oryza sativa miR2118i stem-loop

Gene family

MIPF0000745; MIR2118

Literature search

28 open access papers mention osa-MIR2118i
(163 sentences)

Stem-loop

         ---             aaauu                 c         -a    g        - ---u   gc      cu g     u 
5' gcaagu   aaggaagaggaag     gagugucuaagggcaau ggaauggga  cauu aggaaagc c    aca  gucuuu  c uccac a
   ||||||   |||||||||||||     ||||||||||||||||| |||||||||  |||| |||||||| |    |||  ||||||  | ||||| g
3' cguucg   uuccuucuccuuc     cucauagauuccuguua ccuuacccu  guga uccuuuug g    ugu  uagaaa  g gggug a
         acu             -----                 u         cc    -        u uuuu   aa      ug g     a 

Deep sequencing

2 reads, 0 reads per million, 1 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr4: 21652388-21652568 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR2118i

• osa-MIR2118n: Chr4: 21661494-21661672 [-]
• osa-MIR2118o: Chr4: 21661272-21661426 [-]
• osa-MIR2118m: Chr4: 21658851-21659020 [-]
• osa-MIR2118k: Chr4: 21656944-21657120 [-]
• osa-MIR2118l: Chr4: 21656708-21656884 [-]
• osa-MIR2118j: Chr4: 21654594-21654764 [-]
• osa-MIR2118h: Chr4: 21652652-21652808 [-]
• osa-MIR2118i: Chr4: 21652388-21652568 [-]
• osa-MIR2118f: Chr4: 21650514-21650682 [-]
• osa-MIR5522: Chr4: 21650324-21650436 [+]
• osa-MIR2118g: Chr4: 21650301-21650460 [-]
• osa-MIR2118c: Chr4: 21647968-21648064 [-]
• osa-MIR2118d: Chr4: 21647689-21647864 [-]
• osa-MIR2118e: Chr4: 21647428-21647604 [-]
• osa-MIR2118b: Chr4: 21645285-21645463 [-]
• osa-MIR1869: Chr4: 21644852-21644989 [+]
• osa-MIR2118a: Chr4: 21642923-21643101 [-]

Database links

• miRBase Tracker:MI0011259

Mature sequence osa-miR2118i

• Accession: MIMAT0011748
• Sequence: 122 - uuccuagugccucccauuccua - 143
• Evidence: experimental; 454 [1]

References

1. PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).