Stem-loop sequence osa-MIR2118i

Accession MI0011259
Description Oryza sativa miR2118i stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop 
      ---             aaauu                 c         -a    g        - ---u   gc      cu g     u 
gcaagu   aaggaagaggaag     gagugucuaagggcaau ggaauggga  cauu aggaaagc c    aca  gucuuu  c uccac a
||||||   |||||||||||||     ||||||||||||||||| |||||||||  |||| |||||||| |    |||  ||||||  | ||||| g
cguucg   uuccuucuccuuc     cucauagauuccuguua ccuuacccu  guga uccuuuug g    ugu  uagaaa  g gggug a
      acu             -----                 u         cc    -        u uuuu   aa      ug g     a
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21652388-21652568 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118i
osa-MIR2118n Chr4: 21661494-21661672 [-]
osa-MIR2118o Chr4: 21661272-21661426 [-]
osa-MIR2118m Chr4: 21658851-21659020 [-]
osa-MIR2118k Chr4: 21656944-21657120 [-]
osa-MIR2118l Chr4: 21656708-21656884 [-]
osa-MIR2118j Chr4: 21654594-21654764 [-]
osa-MIR2118h Chr4: 21652652-21652808 [-]
osa-MIR2118i Chr4: 21652388-21652568 [-]
osa-MIR2118f Chr4: 21650514-21650682 [-]
osa-MIR5522 Chr4: 21650324-21650436 [+]
osa-MIR2118g Chr4: 21650301-21650460 [-]
osa-MIR2118c Chr4: 21647968-21648064 [-]
osa-MIR2118d Chr4: 21647689-21647864 [-]
osa-MIR2118e Chr4: 21647428-21647604 [-]
osa-MIR2118b Chr4: 21645285-21645463 [-]
osa-MIR1869 Chr4: 21644852-21644989 [+]
osa-MIR2118a Chr4: 21642923-21643101 [-]

Mature sequence osa-miR2118i

Accession MIMAT0011748
Sequence

122 -  

uuccuagugccucccauuccua

 - 143

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).