Stem-loop sequence osa-MIR2118j

Accession MI0011260
Description Oryza sativa miR2118j stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop 
    --   --c   -        ga   -  u        a            -a   ga      --------       uaag     --     
ggug  agc   agg aagaggaa  gag ac cuaagagc guaggaauggga  cau  aggaaa        gccaaau    cucua  accu 
||||  |||   ||| ||||||||  ||| || |||||||| ||||||||||||  |||  ||||||        |||||||    |||||  ||| c
ccac  ucg   uuc uucuccuu  cuc ug gauucuug uauccuuacccu  gua  uccuuu        ugguuua    gaggu  uggu 
    aa   acu   a        -g   g  -        a            cc   -g      uaguaguc       ----     ua
Get sequence
Deep sequencing
22 reads, 2 experiments
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21654594-21654764 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118j
osa-MIR2118n Chr4: 21661494-21661672 [-]
osa-MIR2118o Chr4: 21661272-21661426 [-]
osa-MIR2118m Chr4: 21658851-21659020 [-]
osa-MIR2118k Chr4: 21656944-21657120 [-]
osa-MIR2118l Chr4: 21656708-21656884 [-]
osa-MIR2118j Chr4: 21654594-21654764 [-]
osa-MIR2118h Chr4: 21652652-21652808 [-]
osa-MIR2118i Chr4: 21652388-21652568 [-]
osa-MIR2118f Chr4: 21650514-21650682 [-]
osa-MIR5522 Chr4: 21650324-21650436 [+]
osa-MIR2118g Chr4: 21650301-21650460 [-]
osa-MIR2118c Chr4: 21647968-21648064 [-]
osa-MIR2118d Chr4: 21647689-21647864 [-]
osa-MIR2118e Chr4: 21647428-21647604 [-]
osa-MIR2118b Chr4: 21645285-21645463 [-]
osa-MIR1869 Chr4: 21644852-21644989 [+]

Mature sequence osa-miR2118j

Accession MIMAT0011749
Sequence

109 -  

uuccugaugccucccauuccua

 - 130

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).