Stem-loop sequence osa-MIR2118l

AccessionMI0011262 (change log)
DescriptionOryza sativa miR2118l stem-loop
Gene family MIPF0000745; MIR2118
Literature search

28 open access papers mention osa-MIR2118l
(164 sentences)

Stem-loop 
      g  uu            aaauu          g              -  a     a       cu    uauuuucu        aga 
5' agc ag  aggaagaggaag     gagugucuaa aacagugggaaugg aa cauua ggaaagc  acag        ucuccacu   a
   ||| ||  ||||||||||||     |||||||||| |||||||||||||| || ||||| |||||||  ||||        ||||||||   u
3' ucg uu  uccuucuccuuc     cucauagauu uuguuauccuuacc uu guaau ccuuuug  uguu        agaggugg   u
      g  -u            -----          g              c  c     -       --    uucuuaau        gga
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21656708-21656884 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118l
osa-MIR2118nChr4: 21661494-21661672 [-]
osa-MIR2118oChr4: 21661272-21661426 [-]
osa-MIR2118mChr4: 21658851-21659020 [-]
osa-MIR2118kChr4: 21656944-21657120 [-]
osa-MIR2118lChr4: 21656708-21656884 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118gChr4: 21650301-21650460 [-]
osa-MIR2118cChr4: 21647968-21648064 [-]
osa-MIR2118dChr4: 21647689-21647864 [-]
osa-MIR2118eChr4: 21647428-21647604 [-]
Database links

Mature sequence osa-miR2118l

Accession MIMAT0011751
Sequence

121 -  

uuccuaaugcuucccauuccua

 - 142

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).