Stem-loop sequence osa-MIR2118m

Accession MI0011263
Description Oryza sativa miR2118m stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop 
    --    --   -       --u  a   u        a            -a   ga       - --caa      -           
ggug  agcc  agg aagagga   ag gac cuaagagc guaggaauggga  cau  aggaaag c     accaag cucuaacucc 
||||  ||||  ||| |||||||   || ||| |||||||| ||||||||||||  |||  ||||||| |     |||||| ||||||||| u
ccac  ucgg  uuc uucuccu   uc cug gauucuug cauccuuacccu  gua  uccuuuu g     ugguuu gagguugagg 
    aa    cu   a       ugu  -   -        a            cc   -g       a caaua      a
Get sequence
Deep sequencing
22 reads, 2 experiments
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21658851-21659020 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118m
osa-MIR2118n Chr4: 21661494-21661672 [-]
osa-MIR2118o Chr4: 21661272-21661426 [-]
osa-MIR2118m Chr4: 21658851-21659020 [-]
osa-MIR2118k Chr4: 21656944-21657120 [-]
osa-MIR2118l Chr4: 21656708-21656884 [-]
osa-MIR2118j Chr4: 21654594-21654764 [-]
osa-MIR2118h Chr4: 21652652-21652808 [-]
osa-MIR2118i Chr4: 21652388-21652568 [-]
osa-MIR2118f Chr4: 21650514-21650682 [-]
osa-MIR5522 Chr4: 21650324-21650436 [+]
osa-MIR2118g Chr4: 21650301-21650460 [-]

Mature sequence osa-miR2118m

Accession MIMAT0011752
Sequence

108 -  

uuccugaugccucccauuccua

 - 129

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).