Stem-loop sequence osa-MIR2118o

Accession MI0011265
Description Oryza sativa miR2118o stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop 
           aaaa   g                 a    - a   ga    au     -   -  c         c  g 
ggaagaggaag    gag gccaaggagcagugggc uggg g cau  agga  gcuua agc cc ucuccaauc uc c
|||||||||||    ||| ||||||||||||||||| |||| | |||  ||||  ||||| ||| || ||||||||| ||  
ccuucuccuuc    cuc ugguuccuuguuauccg accc c gua  uccu  ugagu uug gg agagguuag ag a
           ----   g                 a    u c   -g    cu     a   a  u         -  u
Get sequence
Deep sequencing
91 reads, 4 experiments
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21661272-21661426 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118o
osa-MIR2118n Chr4: 21661494-21661672 [-]
osa-MIR2118o Chr4: 21661272-21661426 [-]
osa-MIR2118m Chr4: 21658851-21659020 [-]
osa-MIR2118k Chr4: 21656944-21657120 [-]
osa-MIR2118l Chr4: 21656708-21656884 [-]
osa-MIR2118j Chr4: 21654594-21654764 [-]
osa-MIR2118h Chr4: 21652652-21652808 [-]
osa-MIR2118i Chr4: 21652388-21652568 [-]

Mature sequence osa-miR2118o

Accession MIMAT0011754
Sequence

107 -  

cuccugaugccucccaagccua

 - 128

Get sequence
Deep sequencing 69 reads, 4 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).