Stem-loop sequence osa-MIR2118q

Accession MI0011267
Description Oryza sativa miR2118q stem-loop
Gene family MIPF0000745; MIR2118
Stem-loop 
      ---             aaa   a    cu    g  a           -a   g a       c ga   u       cu     ag 
gugagc   agggaagaggaag   gag gccu  aaga cg ugggaauagga  cau g ggaaagc u  agc aaauuuu  acucc  u
||||||   |||||||||||||   ||| ||||  |||| || |||||||||||  ||| | ||||||| |  ||| |||||||  |||||   
uacucg   uuccuucuccuuc   cuc ugga  uucu gc auccuuauccu  gua c ccuuuug g  ucg uuuaaag  ugagg  a
      aau             ---   a    --    a  c           cc   g -       c uc   -       au     cu
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 7810709-7810885 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118q
osa-MIR2118q Chr11: 7810709-7810885 [-]
osa-MIR2118r Chr11: 7810223-7810397 [-]
osa-MIR2118p Chr11: 7807433-7807606 [-]

Mature sequence osa-miR2118q

Accession MIMAT0011756
Sequence

118 -  

uucccgaugccuccuauuccua

 - 139

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).