![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence zma-MIR2118c |
|||||
Accession | MI0011273 (change log) | ||||
Description | Zea mays miR2118c stem-loop | ||||
Gene family | MIPF0000745; MIR2118 | ||||
Literature search |
![]()
11 open access papers mention zma-MIR2118c | ||||
Stem-loop |
g uaaa g a c -a gg - --u u 5' g aagaggaag gau aucuaagagc guggg auggga cau aggaaggc c augaggu g | ||||||||| ||| |||||||||| ||||| |||||| ||| |||||||| | ||||||| 3' c uucuccuuc cua uggauucuug uaucc uacccu gua uccuucug g uacucca a g ---- g c u cc -a u uuu a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence zma-miR2118c |
|
Accession | MIMAT0011762 |
Sequence |
85 - uuccuaaugccucccauuccua - 106 |
Deep sequencing | 11 reads, 6 experiments |
Evidence | experimental; 454 [1] |
References |
|
1 |
PMID:19584097
"Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"
Genome Res. 19:1429-1440(2009).
|