![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence zma-MIR2118d |
||||||
Accession | MI0011274 (change log) | |||||
Description | Zea mays miR2118d stem-loop | |||||
Gene family | MIPF0000745; MIR2118 | |||||
Literature search |
![]()
12 open access papers mention zma-MIR2118d | |||||
Stem-loop |
---au g a g g a aca -g --- g 5' gugagc g aagaggaag gag gucuaa agc gugggcauggga cg aggaaggccu augagu g |||||| | ||||||||| ||| |||||| ||| |||||||||||| || |||||||||| |||||| a 3' cacucg c uucuccuuc cuc uggauu uug uauccguacccu gu uccuucuggg uacucg a guuuu g - g g c -cc ag uuu a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence zma-miR2118d |
|
Accession | MIMAT0011763 |
Sequence |
89 - uuccugaugccucccaugccua - 110 |
Deep sequencing | 37 reads, 13 experiments |
Evidence | not experimental |
References |
|
1 |
PMID:19584097
"Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"
Genome Res. 19:1429-1440(2009).
|