Stem-loop sequence zma-MIR2275b

Accession

MI0011279 (change log)

Description

Zea mays miR2275b stem-loop

Gene family

MIPF0000797; MIR2275

Literature search

10 open access papers mention zma-MIR2275b
(15 sentences)

Stem-loop

       c   ag     -        c         --au  u 
5' ccau uga  ugagg auuagagg aacugaacc    ca c
   |||| |||  ||||| |||||||| |||||||||    || u
3' ggua gcu  acucu uaaucucc uugacuugg    gu a
       a   cu     a        u         aaac  u 

Deep sequencing

178 reads, 197 reads per million, 118 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

The mature product from the 5' arm of the hairpin dominates over the 3' arm, but the conservation signature with rice suggests that the 3' arm may be functional [1].

Genome context

• Coordinates (B73_RefGen_v4; GCA_000005005.6): chr4: 31734063-31734144 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from zma-MIR2275b

• zma-MIR2275a: chr4: 31733907-31734028 [+]
• zma-MIR2275b: chr4: 31734063-31734144 [+]

Database links

• RNAcentral:URS000075E18A_4577
• miRBase Tracker:MI0011279

Mature sequence zma-miR2275b-5p

• Accession: MIMAT0011769
• Sequence: 13 - aggauuagaggcaacugaacc - 33
• Deep sequencing: 155 reads, 119 experiments
• Evidence: experimental; 454 [1]
• Database links:
  • RNAcentral:URS000024BA9A_4577

Mature sequence zma-miR2275b-3p

• Accession: MIMAT0011770
• Sequence: 51 - uucaguuuccucuaauaucuca - 72
• Deep sequencing: 3 reads, 1 experiments
• Evidence: experimental; 454 [1]

References

1. PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).