|
miRBase |
|
Stem-loop sequence zma-MIR2275b |
||||||
| Accession | MI0011279 | |||||
| Description | Zea mays miR2275b stem-loop | |||||
| Gene family | MIPF0000797; MIR2275 | |||||
| Stem-loop |
c ag - c --au u ccau uga ugagg auuagagg aacugaacc ca c |||| ||| ||||| |||||||| ||||||||| || u ggua gcu acucu uaaucucc uugacuugg gu a a cu a u aaac u |
|||||
| Comments |
The mature product from the 5' arm of the hairpin dominates over the 3' arm, but the conservation signature with rice suggests that the 3' arm may be functional [1]. |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
Mature sequence zma-miR2275b-5p |
|
| Accession | MIMAT0011769 |
| Sequence |
13 - aggauuagaggcaacugaacc - 33 |
| Evidence | experimental; 454 [1] |
Mature sequence zma-miR2275b-3p |
|
| Accession | MIMAT0011770 |
| Sequence |
51 - uucaguuuccucuaauaucuca - 72 |
| Evidence | experimental; 454 [1] |
References |
|
| 1 |
PMID:19584097
"Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"
Genome Res. 19:1429-1440(2009).
|