![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence zma-MIR2275b |
||||||
Accession | MI0011279 (change log) | |||||
Description | Zea mays miR2275b stem-loop | |||||
Gene family | MIPF0000797; MIR2275 | |||||
Literature search |
![]()
10 open access papers mention zma-MIR2275b | |||||
Stem-loop |
c ag - c --au u 5' ccau uga ugagg auuagagg aacugaacc ca c |||| ||| ||||| |||||||| ||||||||| || u 3' ggua gcu acucu uaaucucc uugacuugg gu a a cu a u aaac u |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
The mature product from the 5' arm of the hairpin dominates over the 3' arm, but the conservation signature with rice suggests that the 3' arm may be functional [1]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence zma-miR2275b-5p |
|
Accession | MIMAT0011769 |
Sequence |
13 - aggauuagaggcaacugaacc - 33 |
Deep sequencing | 155 reads, 119 experiments |
Evidence | experimental; 454 [1] |
Database links |
|
Mature sequence zma-miR2275b-3p |
|
Accession | MIMAT0011770 |
Sequence |
51 - uucaguuuccucuaauaucuca - 72 |
Deep sequencing | 3 reads, 1 experiments |
Evidence | experimental; 454 [1] |
References |
|
1 |
PMID:19584097
"Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"
Genome Res. 19:1429-1440(2009).
|