![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence zma-MIR2275d |
|||||
Accession | MI0011281 (change log) | ||||
Description | Zea mays miR2275d stem-loop | ||||
Gene family | MIPF0000797; MIR2275 | ||||
Literature search |
![]()
10 open access papers mention zma-MIR2275d | ||||
Stem-loop |
gucaggcacuaaaa - a uaau u -ga c aug 5' gugaga guuggaggaaag aaac cggc auca uu ugca g |||||| |||||||||||| |||| |||| |||| || |||| c 3' cacucu uaaucuccuuuu uuug gccg uagu aa acgu u ---------acuuc a g ccuu u aca u agu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence zma-miR2275d-5p |
|
Accession | MIMAT0011773 |
Sequence |
18 - agaguuggaggaaagaaaacu - 38 |
Deep sequencing | 34 reads, 8 experiments |
Evidence | by similarity; MI0011278 |
Mature sequence zma-miR2275d-3p |
|
Accession | MIMAT0011774 |
Sequence |
93 - uuuguuuuccucuaauaucuca - 114 |
Deep sequencing | 3 reads, 2 experiments |
Evidence | by similarity; MI0011278 |
References |
|
1 |
PMID:19584097
"Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"
Genome Res. 19:1429-1440(2009).
|