Stem-loop sequence zma-MIR2275d

Accession

MI0011281 (change log)

Description

Zea mays miR2275d stem-loop

Gene family

MIPF0000797; MIR2275

Literature search

10 open access papers mention zma-MIR2275d
(15 sentences)

Stem-loop

   gucaggcacuaaaa      -            a    uaau    u    -ga  c    aug 
5'               gugaga guuggaggaaag aaac    cggc auca   uu ugca   g
                 |||||| |||||||||||| ||||    |||| ||||   || ||||   c
3'               cacucu uaaucuccuuuu uuug    gccg uagu   aa acgu   u
   ---------acuuc      a            g    ccuu    u    aca  u    agu 

Deep sequencing

140 reads, 983 reads per million, 23 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (B73_RefGen_v4; GCA_000005005.6): chr2: 207980073-207980192 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0011281

Mature sequence zma-miR2275d-5p

• Accession: MIMAT0011773
• Sequence: 18 - agaguuggaggaaagaaaacu - 38
• Deep sequencing: 34 reads, 8 experiments
• Evidence: by similarity; MI0011278

Mature sequence zma-miR2275d-3p

• Accession: MIMAT0011774
• Sequence: 93 - uuuguuuuccucuaauaucuca - 114
• Deep sequencing: 3 reads, 2 experiments
• Evidence: by similarity; MI0011278

References

1. PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).