Stem-loop sequence dme-mir-2280

AccessionMI0011290 (change log)
DescriptionDrosophila melanogaster miR-2280 stem-loop
Stem-loop
   -    uuaa a   ug          g   uc         caa    a     --     
5'  ucgu    g ugc  ugaauauccc uuu  uuagcuugg   uaaa uauua  uuca 
    ||||    | |||  |||||||||| |||  |||||||||   |||| |||||  ||| c
3'  ggca    c acg  acuuauaggg aag  aaucgaacc   auuu augau  aaga 
   a    ---c a   ug          g   uc         uuc    a     ca     
Get sequence
Deep sequencing
68 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 1831685-1831799 [-]
sense
FBtr0077894 ; c-cup-RA; 3'UTR (exon 2)
Database links

Mature sequence dme-miR-2280-5p

Accession MIMAT0011786
Previous IDsdme-miR-2280
Sequence

30 - 

ucuuagcuuggcaauaaaauau

 - 51

Get sequence
Deep sequencing24 reads, 10 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-2280-3p

Accession MIMAT0011787
Previous IDsdme-miR-2280*
Sequence

69 - 

aauuuacuuccaagcuaacuga

 - 90

Get sequence
Deep sequencing10 reads, 8 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:19541914 "Abundant primary piRNAs, endo-siRNAs, and microRNAs in a Drosophila ovary cell line" Lau NC, Robine N, Martin R, Chung WJ, Niki Y, Berezikov E, Lai EC Genome Res. 19:1776-1785(2009).