Stem-loop sequence dme-mir-2281

AccessionMI0011291 (change log)
DescriptionDrosophila melanogaster miR-2281 stem-loop
Stem-loop
         ----c       -ac  -   u  u      c          a   ua 
5' ggaugu     gagcagu   ac gua ua cugcag ugcagaugca aug  u
   ||||||     |||||||   || ||| || |||||| |||||||||| |||   
3' ccuaua     uucgucg   ug cgu au gacguc augucuaugu uau  a
         cuuau       cua  a   u  -      u          c   gu 
Get sequence
Deep sequencing
31 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 14396399-14396501 [-]
sense
FBtr0112631 ; cv-c-RA; intron 2
FBtr0112630 ; cv-c-RC; intron 9
FBtr0112632 ; cv-c-RD; intron 10
Database links

Mature sequence dme-miR-2281-5p

Accession MIMAT0011788
Previous IDsdme-miR-2281*
Sequence

21 - 

auuaucugcagcugcagaugcaa

 - 43

Get sequence
Deep sequencing8 reads, 6 experiments
Evidence experimental; 454 [1]
Predicted targets

Mature sequence dme-miR-2281-3p

Accession MIMAT0011789
Previous IDsdme-miR-2281
Sequence

59 - 

uaucuguaucugcaguauugc

 - 79

Get sequence
Deep sequencing18 reads, 12 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:19541914 "Abundant primary piRNAs, endo-siRNAs, and microRNAs in a Drosophila ovary cell line" Lau NC, Robine N, Martin R, Chung WJ, Niki Y, Berezikov E, Lai EC Genome Res. 19:1776-1785(2009).