Stem-loop sequence dme-mir-2282

AccessionMI0011292 (change log)
DescriptionDrosophila melanogaster miR-2282 stem-loop
Stem-loop
   g   gcauaac  u     uuu   -c          c        cc  gug  u 
5'  ccu       gc guggc   ccg  uucuauuuuu guucacug  uu   cu c
    |||       || |||||   |||  |||||||||| ||||||||  ||   || g
3'  gga       cg caccg   ggc  aagauaaaaa cgaguggc  aa   gg u
   g   ---acuu  -     -uu   uu          u        ua  --a  u 
Get sequence
Deep sequencing
48 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 3412145-3412251 [-]
sense
FBtr0073145 ; sty-RC; intron 1
FBtr0073146 ; sty-RB; intron 1
Database links

Mature sequence dme-miR-2282-3p

Accession MIMAT0011790
Previous IDsdme-miR-2282
Sequence

65 - 

aucggugagcuaaaaauagaau

 - 86

Get sequence
Deep sequencing40 reads, 21 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:19541914 "Abundant primary piRNAs, endo-siRNAs, and microRNAs in a Drosophila ovary cell line" Lau NC, Robine N, Martin R, Chung WJ, Niki Y, Berezikov E, Lai EC Genome Res. 19:1776-1785(2009).