Stem-loop sequence dme-mir-2283

AccessionMI0011293 (change log)
DescriptionDrosophila melanogaster miR-2283 stem-loop
Stem-loop
   -         g           a    gac   u   u 
5'  agcugcucc aaaauaucaug auac   aau aug g
    ||||||||| ||||||||||| ||||   ||| |||  
3'  ucgacgagg uuuuauagugc uaug   uua uac c
   a         a           a    -au   c   a 
Get sequence
Deep sequencing
32 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 9517524-9517599 [+]
sense
FBtr0082063 ; JHDM2-RA; intron 1
FBtr0082064 ; CG8176-RB; intron 1
FBtr0113208 ; CG8176-RD; intron 1
FBtr0082065 ; CG8176-RA; intron 1
FBtr0113207 ; CG8176-RC; intron 1
Database links

Mature sequence dme-miR-2283-5p

Accession MIMAT0011791
Previous IDsdme-miR-2283
Sequence

10 - 

gaaaauaucaugaauacgacaau

 - 32

Get sequence
Deep sequencing9 reads, 5 experiments
Evidence experimental; 454 [1]
Predicted targets

Mature sequence dme-miR-2283-3p

Accession MIMAT0020909
Sequence

48 - 

uaguauacgugauauuuuagg

 - 68

Get sequence
Deep sequencing23 reads, 8 experiments
Evidence not experimental

References

1
PMID:19541914 "Abundant primary piRNAs, endo-siRNAs, and microRNAs in a Drosophila ovary cell line" Lau NC, Robine N, Martin R, Chung WJ, Niki Y, Berezikov E, Lai EC Genome Res. 19:1776-1785(2009).