Stem-loop sequence bta-mir-2286

AccessionMI0011295 (change log)
DescriptionBos taurus miR-2286 stem-loop
Literature search

1 open access papers mention bta-mir-2286
(1 sentences)

Stem-loop
        c  g g -a  -g  a         gguag   a 
5' acgcc ug a g  gu  cg cccugcuuc     ccc u
   ||||| || | |  ||  || |||||||||     |||  
3' ugugg au u u  ca  gc gggacgaag     ggg g
        c  g g ag  ag  -         ---ga   g 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 52327449-52327522 [-]
intergenic
Database links

Mature sequence bta-miR-2286

Accession MIMAT0011793
Sequence

46 - 

gaagcagggcggaacgaugugu

 - 67

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).