Stem-loop sequence bta-mir-2288

AccessionMI0011297 (change log)
DescriptionBos taurus miR-2288 stem-loop
Literature search

1 open access papers mention bta-mir-2288
(1 sentences)

Stem-loop
   ccag      g -------      uu   ---a      acua 
5'     ggcaau u       ccacau  gcc    gcuuuc    a
       |||||| |       ||||||  |||    ||||||     
3'     cuguua a       ggugug  ugg    uggaag    a
   -gga      g uaaauuu      --   auga      auac 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 139830700-139830776 [-]
intergenic
Database links

Mature sequence bta-miR-2288

Accession MIMAT0011795
Sequence

43 - 

agguaguaggugugugguuu

 - 62

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).