Stem-loop sequence bta-mir-2295

AccessionMI0011305 (change log)
DescriptionBos taurus miR-2295 stem-loop
Literature search

1 open access papers mention bta-mir-2295
(3 sentences)

Stem-loop
      -----        g  cu        c  c  c 
5' gcu     ccuuucuc cc  ccccgacc ug ag g
   |||     |||||||| ||  |||||||| || || u
3' cgg     ggaaggag gg  ggggcugg ac uu c
      cucuu        -  -u        -  u  u 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 10923820-10923886 [-]
intergenic
Database links

Mature sequence bta-miR-2295

Accession MIMAT0011803
Sequence

43 - 

ucggggugggaggaagguucu

 - 63

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).