Stem-loop sequence bta-mir-2300a

AccessionMI0011310 (change log)
DescriptionBos taurus miR-2300a stem-loop
Gene family MIPF0000770; mir-2300
Literature search

1 open access papers mention bta-mir-2300a
(1 sentences)

Stem-loop
               c                    g   g 
5' caucuuauuccu agcuaguuuugucucccugu ugu a
   |||||||||||| |||||||||||||||||||| |||  
3' guagaauaagga ucgaucaaaacggagggacg aua u
               a                    a   c 
Get sequence
Deep sequencing
22 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 31918144-31918221 [-]
antisense
ENSBTAT00000061117 ; FLT1-201; intron 18
Clustered miRNAs
< 10kb from bta-mir-2300a
bta-mir-2300bchr12: 31918146-31918219 [+]
bta-mir-2300achr12: 31918144-31918221 [-]
Database links

Mature sequence bta-miR-2300a-5p

Accession MIMAT0011809
Sequence

9 - 

uccucagcuaguuuugucuccc

 - 30

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).