Stem-loop sequence bta-mir-2312

AccessionMI0011329 (change log)
DescriptionBos taurus miR-2312 stem-loop
Stem-loop
   u   gcu    a  c       cu     a     u 
5'  ugg   ggcc aa aguuugu  ggguu uucug a
    |||   |||| || |||||||  ||||| ||||| a
3'  acc   ccgg uu ucaagca  uccaa aaggu c
   a   -ac    c  u       ag     -     u 
Get sequence
Deep sequencing
7924 reads, 40.5 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 32231536-32231608 [+]
sense
ENSBTAT00000022788 ; GRIK4-201; intron 3
antisense
ENSBTAT00000061862 ; bta-mir-2284j-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-2312
bta-mir-2284jchr15: 32231535-32231609 [-]
bta-mir-2312chr15: 32231536-32231608 [+]
Database links

Mature sequence bta-miR-2312

Accession MIMAT0011828
Sequence

44 - 

aaaaccugaacgaacuuuuc

 - 63

Get sequence
Deep sequencing7923 reads, 74 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).