Stem-loop sequence bta-mir-2318

AccessionMI0011339 (change log)
DescriptionBos taurus miR-2318 stem-loop
Gene family MIPF0001968; mir-2318
Literature search

2 open access papers mention bta-mir-2318
(2 sentences)

Stem-loop
   u u   -  acc     uau  u aa    c   ccc   c 
5'  g cag ga   ccgug   ga g  uuau uga   ggc g
    | ||| ||   |||||   || |  |||| |||   |||  
3'  c guc cu   gguac   cu c  aaug acu   ccg u
   a -   a  cuc     --u  u gc    u   -cu   u 
Get sequence
Deep sequencing
400 reads, 0 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 78735576-78735654 [+]
sense
ENSBTAT00000028927 ; MADD-201; intron 14
Database links

Mature sequence bta-miR-2318

Accession MIMAT0011841
Sequence

14 - 

guguaugaugaauuaucugacc

 - 35

Get sequence
Deep sequencing400 reads, 57 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).