Stem-loop sequence bta-mir-2319b

AccessionMI0011341 (change log)
DescriptionBos taurus miR-2319b stem-loop
Gene family MIPF0000790; mir-2319
Literature search

1 open access papers mention bta-mir-2319b
(1 sentences)

Stem-loop
   u                             gaga 
5'  guagcuaagugccuaauacagaguagcau    u
    |||||||||||||||||||||||||||||    c
3'  caucgauucacggauuaugucucauugua    a
   a                             gaau 
Get sequence
Deep sequencing
33 reads, 0 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 78018301-78018371 [+]
antisense
ENSBTAT00000005832 ; CKAP5-201; intron 1
ENSBTAT00000062802 ; bta-mir-2319a-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-2319b
bta-mir-2319achr15: 78018299-78018373 [-]
bta-mir-2319bchr15: 78018301-78018371 [+]
Database links

Mature sequence bta-miR-2319b

Accession MIMAT0011843
Sequence

46 - 

uacucuguauuaggcacuuag

 - 66

Get sequence
Deep sequencing32 reads, 24 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).