Stem-loop sequence bta-mir-2326

AccessionMI0011351 (change log)
DescriptionBos taurus miR-2326 stem-loop
Stem-loop
       ---    ggcggga        --au    gacau 
5' ucug   uggu       uagaggag    gggu     a
   ||||   ||||       ||||||||    ||||     c
3' agac   acua       gucuccuu    ccca     a
       uag    --aaaag        cccc    accga 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 12005708-12005781 [-]
intergenic
Database links

Mature sequence bta-miR-2326

Accession MIMAT0011855
Sequence

45 - 

ccccccuuccucuggaaaaa

 - 64

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).