![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-2326 |
|||||
Accession | MI0011351 (change log) | ||||
Description | Bos taurus miR-2326 stem-loop | ||||
Stem-loop |
--- ggcggga --au gacau 5' ucug uggu uagaggag gggu a |||| |||| |||||||| |||| c 3' agac acua gucuccuu ccca a uag --aaaag cccc accga |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence bta-miR-2326 |
|
Accession | MIMAT0011855 |
Sequence |
45 - ccccccuuccucuggaaaaa - 64 |
Deep sequencing | 1 reads, 1 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:19633723
"Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection"
PLoS One. 4:e6349(2009).
|