Stem-loop sequence bta-mir-2327

AccessionMI0011352 (change log)
DescriptionBos taurus miR-2327 stem-loop
Literature search

1 open access papers mention bta-mir-2327
(1 sentences)

Stem-loop
      c ug     - gc   -      ---------      
5' ccu c  gugcu g  ucu gccccc         caugu 
   ||| |  ||||| |  ||| ||||||         |||| c
3' gga g  cacga c  aga cggggg         guacc 
      c gu     a uc   g      augaacccc      
Get sequence
Deep sequencing
6 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 14043978-14044047 [+]
intergenic
Database links

Mature sequence bta-miR-2327

Accession MIMAT0011856
Sequence

44 - 

agggggcgagacucaagcacuggc

 - 67

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).