Stem-loop sequence bta-mir-2329-1

AccessionMI0011354 (change log)
DescriptionBos taurus miR-2329-1 stem-loop
Gene family MIPF0000785; mir-2329
Literature search

1 open access papers mention bta-mir-2329-1
(1 sentences)

Stem-loop
                                aua 
5' acuuaucagcucacaucacagaucagauc   u
   |||||||||||||||||||||||||||||    
3' ugaauagucgaguguagugucuagucuag   c
                                gac 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 48765693-48765758 [-]
antisense
ENSBTAT00000009228 ; RYR1-201; intron 87
Clustered miRNAs
< 10kb from bta-mir-2329-1
bta-mir-2329-2chr18: 48765693-48765758 [+]
bta-mir-2329-1chr18: 48765693-48765758 [-]
Database links

Mature sequence bta-miR-2329-3p

Accession MIMAT0011859
Sequence

45 - 

ucugugaugugagcugauaagu

 - 66

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).