Stem-loop sequence bta-mir-2329-2

AccessionMI0011355 (change log)
DescriptionBos taurus miR-2329-2 stem-loop
Gene family MIPF0000785; mir-2329
Literature search

1 open access papers mention bta-mir-2329-2
(1 sentences)

Stem-loop
                                cug 
5' acuuaucagcucacaucacagaucagauc   g
   |||||||||||||||||||||||||||||    
3' ugaauagucgaguguagugucuagucuag   a
                                uau 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 48765693-48765758 [+]
sense
ENSBTAT00000009228 ; RYR1-201; intron 87
Clustered miRNAs
< 10kb from bta-mir-2329-2
bta-mir-2329-2chr18: 48765693-48765758 [+]
bta-mir-2329-1chr18: 48765693-48765758 [-]
Database links

Mature sequence bta-miR-2329-5p

Accession MIMAT0011860
Sequence

1 - 

acuuaucagcucacaucacaga

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).