Stem-loop sequence bta-mir-2340

AccessionMI0011368 (change log)
DescriptionBos taurus miR-2340 stem-loop
Literature search

1 open access papers mention bta-mir-2340
(1 sentences)

Stem-loop
   aca  u  aag a        ---a   u   ----a   ga 
5'    ac cc   g uacgaggc    agg aag     uca  g
      || ||   | ||||||||    ||| |||     |||   
3'    ug gg   c guguucug    ucc uuc     agu  u
   -ug  u  -ga -        gugg   c   aggag   ag 
Get sequence
Deep sequencing
177 reads, 192 reads per million, 51 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 39064838-39064913 [+]
sense
ENSBTAT00000000843 ; SKAP1-201; intron 4
Database links

Mature sequence bta-miR-2340

Accession MIMAT0011875
Sequence

45 - 

ggacuucccugguggucuugug

 - 66

Get sequence
Deep sequencing177 reads, 51 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).