Stem-loop sequence bta-mir-2344

AccessionMI0011372 (change log)
DescriptionBos taurus miR-2344 stem-loop
Literature search

1 open access papers mention bta-mir-2344
(1 sentences)

Stem-loop
           cu    c   ag  g  u     
5' gucgauuc  gucc ucg  gu gu cccu 
   ||||||||  |||| |||  || || ||| g
3' caguugag  uagg ggu  ua ca gggg 
           uc    c   ag  g  c     
Get sequence
Deep sequencing
2813 reads, 13.3 reads per million, 45 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 50633090-50633150 [-]
sense
ENSBTAT00000055015 ; TBCD-201; intron 19
ENSBTAT00000020484 ; TBCD-202; intron 20
Database links

Mature sequence bta-miR-2344

Accession MIMAT0011879
Sequence

35 - 

gcacgaugauggcggaucugaguu

 - 58

Get sequence
Deep sequencing2813 reads, 45 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).