miRBase entry: bta-mir-2344

Stem-loop bta-mir-2344


Accession
MI0011372
Description
Bos taurus bta-mir-2344 precursor miRNA

Literature search
1 open access papers mention bta-mir-2344
(1 sentences)

Sequence

2441 reads, 15 reads per million, 44 experiments
gucgauuccugucccucgaggugguucccuggggGCACGAUGAUGGCGGAUCUGAGUUgac
((((((((..((((.(((..((.((.(((...))).)).))..))).))))..))))))))

Structure
        cu    c   ag  g  u   u 
gucgauuc  gucc ucg  gu gu ccc  
||||||||  |||| |||  || || ||| g
cagUUGAG  UAGG GGU  UA CA Ggg  
        UC    C   AG  G  C   g 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr19: 50633090-50633150 [-]

Database links

Mature bta-miR-2344

Accession MIMAT0011879
Description Bos taurus bta-miR-2344 mature miRNA
Sequence 35 - GCACGAUGAUGGCGGAUCUGAGUU - 58
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 19633723
    Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection
    Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ
    PLoS One (2009) 4:e6349