Stem-loop sequence bta-mir-2349

AccessionMI0011377 (change log)
DescriptionBos taurus miR-2349 stem-loop
Literature search

1 open access papers mention bta-mir-2349
(1 sentences)

Stem-loop
   -u  aa c          ug  -  -   g  a 
5'   gg  g agucugaggc  ga gu cca ug g
     ||  | ||||||||||  || || ||| || g
3'   cc  c ucagacucug  cu ca ggu ac a
   ac  aa -          gu  u  c   g  a 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 54443955-54444019 [-]
intergenic
Database links

Mature sequence bta-miR-2349

Accession MIMAT0011884
Sequence

38 - 

uggcacuucuggucucagacuca

 - 60

Get sequence
Deep sequencing24 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).