Stem-loop sequence bta-mir-2368

AccessionMI0011403 (change log)
DescriptionBos taurus miR-2368 stem-loop
Literature search

2 open access papers mention bta-mir-2368
(7 sentences)

Stem-loop
        g -   a       g   c   gu -    g  uua 
5' guggg g agg gcagagg ugg cug  a ucug uc   g
   ||||| | ||| ||||||| ||| |||  | |||| ||   u
3' caccc u ucc cgucucc acc gac  u agac ag   a
        g g   c       -   a   ug c    -  uuu 
Get sequence
Deep sequencing
64 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 15960043-15960123 [+]
sense
ENSBTAT00000030970 ; SNRK-201; intron 1
Database links

Mature sequence bta-miR-2368-5p

Accession MIMAT0011911
Previous IDsbta-miR-2368
Sequence

14 - 

agaggguggccugguaucug

 - 33

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence bta-miR-2368-3p

Accession MIMAT0011912
Previous IDsbta-miR-2368*
Sequence

51 - 

acugucagaccaccucugcc

 - 70

Get sequence
Deep sequencing59 reads, 35 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).