Stem-loop sequence bta-mir-2374

AccessionMI0011409 (change log)
DescriptionBos taurus miR-2374 stem-loop
Literature search

1 open access papers mention bta-mir-2374
(2 sentences)

Stem-loop
      --g g    g g  -g     g  ag  g   g   g 
5' cgc   a gcgg c gc  uuccc gg  cc ggc cuc g
   |||   | |||| | ||  ||||| ||  || ||| |||  
3' gcg   u cgcc g cg  gaggg uc  gg uug ggg g
      gag g    g g  ga     g  -g  g   -   c 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 60062472-60062548 [+]
intergenic
Database links

Mature sequence bta-miR-2374

Accession MIMAT0011920
Sequence

45 - 

uuggggcuggggagaggcggg

 - 65

Get sequence
Deep sequencing7 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).